Biolegio has rapidly scaled up production on RT-qPCR Primers and Probes for 2019 Novel Coronavirus (2019-nCoV)                                                                              

Biolegio has rapidly scaled up production capabilities to deliver primers and probes for RT-qPCR Testing for 2019 Novel Coronavirus (2019-nCoV) and have been supplying laboratories and customers sufficient primer and probe sets to perform 10s of millions of tests.


Following the demand from customers we have specifically focused on the production of the primer and probe sets described in the assay protocol developed by Charité, Berlin/Erasmus MC/Public Health England - In order to streamline and maximise production with as few primer / probe sequences and labels as possible and therefore help our customers with delivering as many tests as possible at this time.

We are synthesising these Oligos consistently and attempting to maintain a permanent stock to fulfil on going customer requirements and new enquires as soon as possible, with immediate dispatch potentially available (subject to volume requirements and current stock situation) and preferential bulk pricing.

For details please contact Steve Garside – Business Development Manager Tel: +44(0)781 3114509 or info@biolegio.com 

 

Charité, Berlin/Erasmus MC/Public Health England Protocol – Primers & Probes:

 Gene  Oligo ID  Sequence (5'-3')  5' Label
 RdRP gene



 RdRP_SARSr-F2  GTGARATGGTCATGTGTGGCGG  
 RdRP_SARSr-R1  CARATGTTAAASACACTATTAGCATA  
 RdRP_SARSr-P2  CAGGTGGAACCTCATCAGGAGATGC  FAM
 RdRP_SARSr-P1  CCAGGTGGWACRTCATCMGGTGATGC  FAM
       
 E gene

 E_Sarbeco_F1  ACAGGTACGTTAATAGTTAATAGCGT  
 E_Sarbeco_R2  ATATTGCAGCAGTACGCACACA  
 E_Sarbeco_P1  ACACTAGCCATCCTTACTGCGCTTCG  FAM

 

 

We also have available the published primer and probes sequences for the N1, N2 and RP assays utilised in the US CDC protocol.

 

US CDC Primers & Probe Sequences:

 Gene  Oligo ID  Sequence (5'-3')  5' Label
 N1



 2019-nCoV_N1 Forward Primer  GAC CCC AAA ATC AGC GAA AT  
 2019-nCoV_N1 Reverse Primer  TCT GGT TAC TGC CAG TTG AAT CTG  
 2019-nCoV_N1 Probe  ACC CCG CAT TAC GTT TGG TGG ACC  FAM
       
 N2

 2019-nCoV_N2 Forward Primer  TTA CAA ACA TTG GCC GCA AA  
 2019-nCoV_N2 Reverse Primer  GCG CGA CAT TCC GAA GAA  
 2019-nCoV_N2 Probe  ACA ATT TGC CCC CAG CGC TTC AG  FAM
       
RP  RNAse P Forward Primer  AGA TTT GGA CCT GCG AGC G  
 RNAse P Reverse Primer  GAG CGG CTG TCT CCA CAA GT  
 RNAse P Probe  TTC TGA CCT GAA GGC TCT GCG CG  FAM

 

We also are holding stock of many of the probes from both protocol sets with alternative 5’ Fluorophore labels – contact us for further details.

 

We continue to synthesise primer/probe sets from other protocols for testing for 2019-nCoV, including those from the China CDC & Institut Pasteur as well custom Oligonucleotide for other applications as per our normal service. Please contact us for further info.


All primer and probes are for research use only, not for use in diagnostic procedures.